c terminus Search Results


93
Neuromics gp14100
Gp14100, supplied by Neuromics, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/pmc05081582-410-107-106?v=Neuromics
Average 93 stars, based on 1 article reviews
gp14100 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
R&D Systems monoclonal mouse anti human ctgf ccn2 c terminus
Monoclonal Mouse Anti Human Ctgf Ccn2 C Terminus, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/pmc04257608-23-1-14?v=R%26D+Systems
Average 90 stars, based on 1 article reviews
monoclonal mouse anti human ctgf ccn2 c terminus - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

96
R&D Systems cftr
Differentiated primary HBE cell cultures grown at an air-liquid interface were incubated with 50ng/ml TNFα for 10–30min, 3–6h and 24h. <t>CFTR</t> immunodetection was performed with <t>24.1</t> <t>anti-CFTR</t> antibody and analyzed with confocal microscopy. Green staining represents CFTR (Alexa Fluor 488), red color staining represents ZO-1 protein of tight junctions (Alexa Fluor 594) and blue DAPI staining visualizes nuclei. Independent TNFα treatments and CFTR immunodetection were performed on HBE cells from three different F508del/F508del CF patients. Representative images of one experiment are demonstrated (Scale bars = 20µm).
Cftr, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/pmc04648213-31-21-22?v=R%26D+Systems
Average 96 stars, based on 1 article reviews
cftr - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

94
Novus Biologicals periostin
(A) Whole ventricle mRNA microarray analysis of Col1a2 -/- mouse hearts compared to Col1a2 +/- at 2 months of age, n=3 per genotype. (B) Mass spectrometry analysis of ECM protein changes in Col1a2 -/- mouse hearts compared to Col1a2 +/- hearts at 3 months of age, n=4 per genotype. (C) Representative immunofluorescence images and (D) Western blot analysis of <t>periostin</t> from hearts of Col1a2 +/- and Col1a2 -/- mice at 3 months of age. Scale bar: 25 µm. (E) Flow cytometric gate strategy and (F) analysis of cardiac fibroblasts (MEFSK4 + /CD31 - /CD45 - ) from dissociated hearts of Col1a2 +/- and Col1a2 -/- mice at 3 months of age. (G) Representative immunofluorescence images of platelet-derived growth factor receptor (PDGFR)-α (purple) in Col1a2 +/- and Col1a2 -/- mice at 3 months of age. Wheat germ agglutinin (WGA) staining is green and shows outlines of cardiomyocytes. Scale bar: 100 µm. Relative mRNA expression of Col1a2 (H), Postn (I), Col3a1 (J) and Col5a1 (K) in sorted cardiac fibroblasts (MEFSK4 + /CD31 - /CD45 - ) from Col1a2 +/- and Col1a2 -/- mice at 9 months of age. Student t -test for panels (F), (H), (I), (J) and (K).
Periostin, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/bio_rxiv__2022__05__25__493406-41-7-8?v=Novus+Biologicals
Average 94 stars, based on 1 article reviews
periostin - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
Novus Biologicals mab22101 brca1 clone 8f7 novus biologicals
Figure 6. Histone H2A ubiquitination accompanied by <t>BRCA1</t> activation is the hallmark phenotype of BRAP LOF (A) Immunoblotting of histone extracts from NPCs as well as from embryonic, neonatal, adult cerebral cortical tissues, and quantification (Mean G SD) of increases in histone H2Aub (total H2Aub and H2AubK119, respectively) resulted from Brap LOF. n = 3–6 biological replicates. p-values calculated by Student’s t test are indicated. (B) Immunoblotting of Brca1 in various cells and tissues, showing that Brap LOF results in increased Brca1 abundance. (C) Immunoblotting of nuclear vs cytoplasmic fractions of MEFs at P1, showing increased nuclear localization of Brca1 in Brap/ cells. (D) Brca1 (red) and NeuN (green) double immunohistology images of cerebral cortical sections of BrapcKONPC and control mice at four months of age. Representative images are shown. Note the increased intensity and density of Brca1 puncta in the nuclei of BrapcKONPC cortical neurons (NeuN+). (E and F) Immunoblotting analyses of histone extracts from cerebral cortical tissues of three-month-old mice, showing increased ubiquitination of H2A variants targeted by Brca1 (E) along with total histone H2A ubiquitination (F). (G) Double immunohistology staining of cortical sections of 4-month old WT or BrapcKONPC mice with antibodies against Gfap (green) and histone H3 (red), showing reduced nuclear histones in cells surrounded by reactive astrocytes (circles) in BrapcKONPC cortical tissues. Representative images are shown. Nuclear DNA was stained with Hoechst 33342. Bars: 50 um or as indicated. See also Figure S3.
Mab22101 Brca1 Clone 8f7 Novus Biologicals, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/pm35754718-337-55-59?v=Novus+Biologicals
Average 94 stars, based on 1 article reviews
mab22101 brca1 clone 8f7 novus biologicals - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
Neuromics rabbit anti trpv1
Figure 6. Histone H2A ubiquitination accompanied by <t>BRCA1</t> activation is the hallmark phenotype of BRAP LOF (A) Immunoblotting of histone extracts from NPCs as well as from embryonic, neonatal, adult cerebral cortical tissues, and quantification (Mean G SD) of increases in histone H2Aub (total H2Aub and H2AubK119, respectively) resulted from Brap LOF. n = 3–6 biological replicates. p-values calculated by Student’s t test are indicated. (B) Immunoblotting of Brca1 in various cells and tissues, showing that Brap LOF results in increased Brca1 abundance. (C) Immunoblotting of nuclear vs cytoplasmic fractions of MEFs at P1, showing increased nuclear localization of Brca1 in Brap/ cells. (D) Brca1 (red) and NeuN (green) double immunohistology images of cerebral cortical sections of BrapcKONPC and control mice at four months of age. Representative images are shown. Note the increased intensity and density of Brca1 puncta in the nuclei of BrapcKONPC cortical neurons (NeuN+). (E and F) Immunoblotting analyses of histone extracts from cerebral cortical tissues of three-month-old mice, showing increased ubiquitination of H2A variants targeted by Brca1 (E) along with total histone H2A ubiquitination (F). (G) Double immunohistology staining of cortical sections of 4-month old WT or BrapcKONPC mice with antibodies against Gfap (green) and histone H3 (red), showing reduced nuclear histones in cells surrounded by reactive astrocytes (circles) in BrapcKONPC cortical tissues. Representative images are shown. Nuclear DNA was stained with Hoechst 33342. Bars: 50 um or as indicated. See also Figure S3.
Rabbit Anti Trpv1, supplied by Neuromics, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/pmc02826808-60-40-43?v=Neuromics
Average 93 stars, based on 1 article reviews
rabbit anti trpv1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Neuromics shank 1a
A–C : A. Image of a retinal section immunostained for Shank <t>1A.</t> B. Mouse YFP-16 line vertical retinal section. C. Shank 1A (red) immunolabeling and YFP (yellow). Shank1A expression is restricted to the OPL and IPL. A regular pattern of Shank 1A immunolabeling appears in the OPL, which is indicative of cone photoreceptor terminals. D–E : High magnification zoom of the OPL demonstrates that Shank 1A puncta (red) are distal to the dendrite tips (yellow) of YFP labeled cone bipolar cells, suggesting that Shank 1A is expressed presynaptic to the YFP cone bipolar cell dendrite. G–L : High magnification zoom of the IPL demonstrates that Shank 1A puncta are likely expressed postsynaptically to bipolar cell terminals. G. Shank 1A immunoreactive puncta. H. YFP labeled neurons and processes within the IPL region. I. PKCα labeled rod bipolar cell axons and terminals. J. Combined Shank 1A (red) and PKCα (blue) immunolabeling illustrate that shank 1A puncta are postsynaptic to rod bipolar cell terminals in the IPL. K. Combined Shank 1A (red) immunolabeling and YFP (yellow) in the IPL demonstrate that Shank 1A puncta are postsynaptic to cone bipolar cell terminals in the IPL. L. Combined triple fluorescent image of Shank 1A (red), PKCα (blue), and YFP (yellow) in the IPL. OPL = outer plexiform layer, INL = inner nuclear layer, IPL = inner plexiform layer, and GCL = ganglion cell layer. Scale bars = 10 µm.
Shank 1a, supplied by Neuromics, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/pmc03440378-154-68-74?v=Neuromics
Average 93 stars, based on 1 article reviews
shank 1a - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

96
Qiagen paper n a recombinant dna plasmid pqe60 qiagen
KEY RESOURCES TABLE
Paper N A Recombinant Dna Plasmid Pqe60 Qiagen, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/pmc06375740-556-23-29?v=Qiagen
Average 96 stars, based on 1 article reviews
paper n a recombinant dna plasmid pqe60 qiagen - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

93
Novus Biologicals anti anapc11
KEY RESOURCES TABLE
Anti Anapc11, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/ppr0631610-56-12-14?v=Novus+Biologicals
Average 93 stars, based on 1 article reviews
anti anapc11 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
Novus Biologicals primary antibodies for periostin
KEY RESOURCES TABLE
Primary Antibodies For Periostin, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/pm34018851-58-0-4?v=Novus+Biologicals
Average 94 stars, based on 1 article reviews
primary antibodies for periostin - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
Novus Biologicals gdf15
KEY RESOURCES TABLE
Gdf15, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/pm41824793-337-53-56?v=Novus+Biologicals
Average 94 stars, based on 1 article reviews
gdf15 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
R&D Systems bax mab846
KEY RESOURCES TABLE
Bax Mab846, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c+terminus/pmc06241119-43-7-31?v=R%26D+Systems
Average 90 stars, based on 1 article reviews
bax mab846 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Differentiated primary HBE cell cultures grown at an air-liquid interface were incubated with 50ng/ml TNFα for 10–30min, 3–6h and 24h. CFTR immunodetection was performed with 24.1 anti-CFTR antibody and analyzed with confocal microscopy. Green staining represents CFTR (Alexa Fluor 488), red color staining represents ZO-1 protein of tight junctions (Alexa Fluor 594) and blue DAPI staining visualizes nuclei. Independent TNFα treatments and CFTR immunodetection were performed on HBE cells from three different F508del/F508del CF patients. Representative images of one experiment are demonstrated (Scale bars = 20µm).

Journal: F1000Research

Article Title: An unexpected effect of TNF-α on F508del-CFTR maturation and function

doi: 10.12688/f1000research.6683.2

Figure Lengend Snippet: Differentiated primary HBE cell cultures grown at an air-liquid interface were incubated with 50ng/ml TNFα for 10–30min, 3–6h and 24h. CFTR immunodetection was performed with 24.1 anti-CFTR antibody and analyzed with confocal microscopy. Green staining represents CFTR (Alexa Fluor 488), red color staining represents ZO-1 protein of tight junctions (Alexa Fluor 594) and blue DAPI staining visualizes nuclei. Independent TNFα treatments and CFTR immunodetection were performed on HBE cells from three different F508del/F508del CF patients. Representative images of one experiment are demonstrated (Scale bars = 20µm).

Article Snippet: Anti-CFTR antibodies (abs): MM13-4 mouse monoclonal ab against N-terminus of CFTR, (Millipore, France, 05-581); 24-1 mouse monoclonal ab against C-terminus of CFTR (R&D Systems, MAB, 25031).

Techniques: Incubation, Immunodetection, Confocal Microscopy, Staining

(A) Whole ventricle mRNA microarray analysis of Col1a2 -/- mouse hearts compared to Col1a2 +/- at 2 months of age, n=3 per genotype. (B) Mass spectrometry analysis of ECM protein changes in Col1a2 -/- mouse hearts compared to Col1a2 +/- hearts at 3 months of age, n=4 per genotype. (C) Representative immunofluorescence images and (D) Western blot analysis of periostin from hearts of Col1a2 +/- and Col1a2 -/- mice at 3 months of age. Scale bar: 25 µm. (E) Flow cytometric gate strategy and (F) analysis of cardiac fibroblasts (MEFSK4 + /CD31 - /CD45 - ) from dissociated hearts of Col1a2 +/- and Col1a2 -/- mice at 3 months of age. (G) Representative immunofluorescence images of platelet-derived growth factor receptor (PDGFR)-α (purple) in Col1a2 +/- and Col1a2 -/- mice at 3 months of age. Wheat germ agglutinin (WGA) staining is green and shows outlines of cardiomyocytes. Scale bar: 100 µm. Relative mRNA expression of Col1a2 (H), Postn (I), Col3a1 (J) and Col5a1 (K) in sorted cardiac fibroblasts (MEFSK4 + /CD31 - /CD45 - ) from Col1a2 +/- and Col1a2 -/- mice at 9 months of age. Student t -test for panels (F), (H), (I), (J) and (K).

Journal: bioRxiv

Article Title: Cardiac fibroblasts regulate cardiomyocyte hypertrophy through dynamic regulation of type I collagen

doi: 10.1101/2022.05.25.493406

Figure Lengend Snippet: (A) Whole ventricle mRNA microarray analysis of Col1a2 -/- mouse hearts compared to Col1a2 +/- at 2 months of age, n=3 per genotype. (B) Mass spectrometry analysis of ECM protein changes in Col1a2 -/- mouse hearts compared to Col1a2 +/- hearts at 3 months of age, n=4 per genotype. (C) Representative immunofluorescence images and (D) Western blot analysis of periostin from hearts of Col1a2 +/- and Col1a2 -/- mice at 3 months of age. Scale bar: 25 µm. (E) Flow cytometric gate strategy and (F) analysis of cardiac fibroblasts (MEFSK4 + /CD31 - /CD45 - ) from dissociated hearts of Col1a2 +/- and Col1a2 -/- mice at 3 months of age. (G) Representative immunofluorescence images of platelet-derived growth factor receptor (PDGFR)-α (purple) in Col1a2 +/- and Col1a2 -/- mice at 3 months of age. Wheat germ agglutinin (WGA) staining is green and shows outlines of cardiomyocytes. Scale bar: 100 µm. Relative mRNA expression of Col1a2 (H), Postn (I), Col3a1 (J) and Col5a1 (K) in sorted cardiac fibroblasts (MEFSK4 + /CD31 - /CD45 - ) from Col1a2 +/- and Col1a2 -/- mice at 9 months of age. Student t -test for panels (F), (H), (I), (J) and (K).

Article Snippet: Antibodies against the following proteins were used: periostin (Novus Biologicals NBP1-30042; 1:300 dilution for IF, 1:1000 for Western blot); collagen I (Abcam ab21286; 1:100 for IF); PDGFRα from (R&D Systems AF1062; 1:1000 for IF); collagen 1a2 (Santa Cruz sc-393573; 1:500 for Western blot) Anti-CD31 was from BioLegend (102423; 1:100 for flow cytometry); anti-CD45 was from BD Biosciences (563890; 1:100 for flow cytometry); anti-MEFSK4 was from Miltenyi Biotec (130-120-802; used 1:30 for flow cytometry).

Techniques: Microarray, Mass Spectrometry, Immunofluorescence, Western Blot, Derivative Assay, Staining, Expressing

Figure 6. Histone H2A ubiquitination accompanied by BRCA1 activation is the hallmark phenotype of BRAP LOF (A) Immunoblotting of histone extracts from NPCs as well as from embryonic, neonatal, adult cerebral cortical tissues, and quantification (Mean G SD) of increases in histone H2Aub (total H2Aub and H2AubK119, respectively) resulted from Brap LOF. n = 3–6 biological replicates. p-values calculated by Student’s t test are indicated. (B) Immunoblotting of Brca1 in various cells and tissues, showing that Brap LOF results in increased Brca1 abundance. (C) Immunoblotting of nuclear vs cytoplasmic fractions of MEFs at P1, showing increased nuclear localization of Brca1 in Brap/ cells. (D) Brca1 (red) and NeuN (green) double immunohistology images of cerebral cortical sections of BrapcKONPC and control mice at four months of age. Representative images are shown. Note the increased intensity and density of Brca1 puncta in the nuclei of BrapcKONPC cortical neurons (NeuN+). (E and F) Immunoblotting analyses of histone extracts from cerebral cortical tissues of three-month-old mice, showing increased ubiquitination of H2A variants targeted by Brca1 (E) along with total histone H2A ubiquitination (F). (G) Double immunohistology staining of cortical sections of 4-month old WT or BrapcKONPC mice with antibodies against Gfap (green) and histone H3 (red), showing reduced nuclear histones in cells surrounded by reactive astrocytes (circles) in BrapcKONPC cortical tissues. Representative images are shown. Nuclear DNA was stained with Hoechst 33342. Bars: 50 um or as indicated. See also Figure S3.

Journal: iScience

Article Title: Histone H2A ubiquitination resulting from Brap loss of function connects multiple aging hallmarks and accelerates neurodegeneration.

doi: 10.1016/j.isci.2022.104519

Figure Lengend Snippet: Figure 6. Histone H2A ubiquitination accompanied by BRCA1 activation is the hallmark phenotype of BRAP LOF (A) Immunoblotting of histone extracts from NPCs as well as from embryonic, neonatal, adult cerebral cortical tissues, and quantification (Mean G SD) of increases in histone H2Aub (total H2Aub and H2AubK119, respectively) resulted from Brap LOF. n = 3–6 biological replicates. p-values calculated by Student’s t test are indicated. (B) Immunoblotting of Brca1 in various cells and tissues, showing that Brap LOF results in increased Brca1 abundance. (C) Immunoblotting of nuclear vs cytoplasmic fractions of MEFs at P1, showing increased nuclear localization of Brca1 in Brap/ cells. (D) Brca1 (red) and NeuN (green) double immunohistology images of cerebral cortical sections of BrapcKONPC and control mice at four months of age. Representative images are shown. Note the increased intensity and density of Brca1 puncta in the nuclei of BrapcKONPC cortical neurons (NeuN+). (E and F) Immunoblotting analyses of histone extracts from cerebral cortical tissues of three-month-old mice, showing increased ubiquitination of H2A variants targeted by Brca1 (E) along with total histone H2A ubiquitination (F). (G) Double immunohistology staining of cortical sections of 4-month old WT or BrapcKONPC mice with antibodies against Gfap (green) and histone H3 (red), showing reduced nuclear histones in cells surrounded by reactive astrocytes (circles) in BrapcKONPC cortical tissues. Representative images are shown. Nuclear DNA was stained with Hoechst 33342. Bars: 50 um or as indicated. See also Figure S3.

Article Snippet: Phospho-p53 (Ser15) Abcam Cat# ab1431; RRID:AB_301090 Phospho-p53 (Ser15) (D4S1H) Cell Signaling Technology Cat# 12571; RRID:AB_2714036 Phospho-p53 (Ser15) (16G8) Cell Signaling Technology Cat# 9286; RRID:AB_331741 Phospho-ATM(Ser1981) Novus Biologicals Cat# AF1655 Phospho-ATR (Ser 428) Cell Signaling Technology Cat# 2853; RRID:AB_2290281 53 BP1 Novus Biologicals Cat# NB100-304 Brca1 Santa Cruz Biotechnology Cat# sc-642; RRID:AB_630944 Brca1 Novus Biologicals Cat# MAB22101 Brca1 (clone 8F7) Novus Biologicals Cat# NBP1-41186 LC3B (G-9) Santa Cruz Biotechnology Cat# sc-376404; RRID:AB_11150489 LC3B Cell Signaling Technology Cat# 2775; RRID:AB_915950 LC3B Novus Biologicals Cat# NB100-2220 p62SQSTM1 Novus Biologicals Cat# MAB8028 p62SQSTM1 GeneTex Cat# GTX100685; RRID:AB_2038029

Techniques: Ubiquitin Proteomics, Activation Assay, Western Blot, Control, Staining

A–C : A. Image of a retinal section immunostained for Shank 1A. B. Mouse YFP-16 line vertical retinal section. C. Shank 1A (red) immunolabeling and YFP (yellow). Shank1A expression is restricted to the OPL and IPL. A regular pattern of Shank 1A immunolabeling appears in the OPL, which is indicative of cone photoreceptor terminals. D–E : High magnification zoom of the OPL demonstrates that Shank 1A puncta (red) are distal to the dendrite tips (yellow) of YFP labeled cone bipolar cells, suggesting that Shank 1A is expressed presynaptic to the YFP cone bipolar cell dendrite. G–L : High magnification zoom of the IPL demonstrates that Shank 1A puncta are likely expressed postsynaptically to bipolar cell terminals. G. Shank 1A immunoreactive puncta. H. YFP labeled neurons and processes within the IPL region. I. PKCα labeled rod bipolar cell axons and terminals. J. Combined Shank 1A (red) and PKCα (blue) immunolabeling illustrate that shank 1A puncta are postsynaptic to rod bipolar cell terminals in the IPL. K. Combined Shank 1A (red) immunolabeling and YFP (yellow) in the IPL demonstrate that Shank 1A puncta are postsynaptic to cone bipolar cell terminals in the IPL. L. Combined triple fluorescent image of Shank 1A (red), PKCα (blue), and YFP (yellow) in the IPL. OPL = outer plexiform layer, INL = inner nuclear layer, IPL = inner plexiform layer, and GCL = ganglion cell layer. Scale bars = 10 µm.

Journal: PLoS ONE

Article Title: Association of Shank 1A Scaffolding Protein with Cone Photoreceptor Terminals in the Mammalian Retina

doi: 10.1371/journal.pone.0043463

Figure Lengend Snippet: A–C : A. Image of a retinal section immunostained for Shank 1A. B. Mouse YFP-16 line vertical retinal section. C. Shank 1A (red) immunolabeling and YFP (yellow). Shank1A expression is restricted to the OPL and IPL. A regular pattern of Shank 1A immunolabeling appears in the OPL, which is indicative of cone photoreceptor terminals. D–E : High magnification zoom of the OPL demonstrates that Shank 1A puncta (red) are distal to the dendrite tips (yellow) of YFP labeled cone bipolar cells, suggesting that Shank 1A is expressed presynaptic to the YFP cone bipolar cell dendrite. G–L : High magnification zoom of the IPL demonstrates that Shank 1A puncta are likely expressed postsynaptically to bipolar cell terminals. G. Shank 1A immunoreactive puncta. H. YFP labeled neurons and processes within the IPL region. I. PKCα labeled rod bipolar cell axons and terminals. J. Combined Shank 1A (red) and PKCα (blue) immunolabeling illustrate that shank 1A puncta are postsynaptic to rod bipolar cell terminals in the IPL. K. Combined Shank 1A (red) immunolabeling and YFP (yellow) in the IPL demonstrate that Shank 1A puncta are postsynaptic to cone bipolar cell terminals in the IPL. L. Combined triple fluorescent image of Shank 1A (red), PKCα (blue), and YFP (yellow) in the IPL. OPL = outer plexiform layer, INL = inner nuclear layer, IPL = inner plexiform layer, and GCL = ganglion cell layer. Scale bars = 10 µm.

Article Snippet: Three Shank 1 antibodies were used for this study: 1) a rabbit polyclonal antibody raised against the COOH-terminal region of Shank 1A (1∶1000) using the product of pGex4T-1 synamon-16, which is the COOH-terminal region of Shank 1A (a generous gift from Dr. Yukata Hata, Tokyo Medical and Dental University, Tokyo, Japan ; 2) a rabbit polyclonal antibody raised against the following sequence SGPIYPGLFDIRSS in the COOH-terminal region of Shank 1A (1∶500–1∶1000) (Catalog No. RA19016, Neuromics, Edina, MN); and 3) a guinea pig polyclonal Shank 1 antibody (1∶20–1∶25) was generated through the use of a glutathione S-transferase (GST)-fusion of the PDZ domain of SSTRIP/Shank 1.

Techniques: Immunolabeling, Expressing, Labeling

A : Shank 1A immunoreactivity in wild type mouse retina, punctate antibody labeling in the OPL in the outer retina and throughout the IPL. B : No Shank 1A immunoreactivity was found in retinal sections obtained from animals where the Shank 1 gene was deleted. (OS = outer segment, ONL = outer nuclear layer, OPL = outer plexiform layer, INL = inner nuclear layer, IPL = inner plexiform layer, and GCL = ganglion cell layer). Scale bar is 10 µm.

Journal: PLoS ONE

Article Title: Association of Shank 1A Scaffolding Protein with Cone Photoreceptor Terminals in the Mammalian Retina

doi: 10.1371/journal.pone.0043463

Figure Lengend Snippet: A : Shank 1A immunoreactivity in wild type mouse retina, punctate antibody labeling in the OPL in the outer retina and throughout the IPL. B : No Shank 1A immunoreactivity was found in retinal sections obtained from animals where the Shank 1 gene was deleted. (OS = outer segment, ONL = outer nuclear layer, OPL = outer plexiform layer, INL = inner nuclear layer, IPL = inner plexiform layer, and GCL = ganglion cell layer). Scale bar is 10 µm.

Article Snippet: Three Shank 1 antibodies were used for this study: 1) a rabbit polyclonal antibody raised against the COOH-terminal region of Shank 1A (1∶1000) using the product of pGex4T-1 synamon-16, which is the COOH-terminal region of Shank 1A (a generous gift from Dr. Yukata Hata, Tokyo Medical and Dental University, Tokyo, Japan ; 2) a rabbit polyclonal antibody raised against the following sequence SGPIYPGLFDIRSS in the COOH-terminal region of Shank 1A (1∶500–1∶1000) (Catalog No. RA19016, Neuromics, Edina, MN); and 3) a guinea pig polyclonal Shank 1 antibody (1∶20–1∶25) was generated through the use of a glutathione S-transferase (GST)-fusion of the PDZ domain of SSTRIP/Shank 1.

Techniques: Antibody Labeling

A–D : Zoomed confocal region of the OPL immunostained with rabbit anti-Shank1A and mouse anti-PSD-95 antibodies. A. Shank 1A puncta labeling in the OPL in the mouse retina. B. PSD-95 immunolabels rod and cone photoreceptor terminals in the OPL. C. YFP labeled dendrites from cone bipolar cells in the OPL. D. Merged confocal image showing Shank 1A (red), PSD-95 (blue), and YFP (yellow). E–J : High magnification single plane confocal images of Shank 1A and PSD-95 in the mouse thy 1.2 YFP 16 line retina (100× objective, N.A. 1.3). E. Shank1 A (red). F. PSD-95 (blue). G. YFP (yellow). H. Merged image of YFP and Shank 1A, YFP and Shank 1A puncta are not co-localized at cone bipolar cell dendrites (see arrowheads, shank fluorescence above YFP dendrite. I. Merged image of Shank 1A and PSD-95, the two immunoreactivities (pink) indicate co-localization of Shank 1a and PSD-95 (see arrows which indicate that Shank 1A is co-localized with PSD-95). Arrows indicate location of Shank 1A immunoractive puncta co-localized with PSD-95. J. Merged image of inset Shank 1A (red), PSD-95 (blue), and YFP (yellow). Primary antibodies were detected using a secondary goat anti-rabbit Alexa 568 IgG for Shank 1A, and a goat anti-mouse Alexa 633 IgG to PSD-95. Scale bar is 5 µm.

Journal: PLoS ONE

Article Title: Association of Shank 1A Scaffolding Protein with Cone Photoreceptor Terminals in the Mammalian Retina

doi: 10.1371/journal.pone.0043463

Figure Lengend Snippet: A–D : Zoomed confocal region of the OPL immunostained with rabbit anti-Shank1A and mouse anti-PSD-95 antibodies. A. Shank 1A puncta labeling in the OPL in the mouse retina. B. PSD-95 immunolabels rod and cone photoreceptor terminals in the OPL. C. YFP labeled dendrites from cone bipolar cells in the OPL. D. Merged confocal image showing Shank 1A (red), PSD-95 (blue), and YFP (yellow). E–J : High magnification single plane confocal images of Shank 1A and PSD-95 in the mouse thy 1.2 YFP 16 line retina (100× objective, N.A. 1.3). E. Shank1 A (red). F. PSD-95 (blue). G. YFP (yellow). H. Merged image of YFP and Shank 1A, YFP and Shank 1A puncta are not co-localized at cone bipolar cell dendrites (see arrowheads, shank fluorescence above YFP dendrite. I. Merged image of Shank 1A and PSD-95, the two immunoreactivities (pink) indicate co-localization of Shank 1a and PSD-95 (see arrows which indicate that Shank 1A is co-localized with PSD-95). Arrows indicate location of Shank 1A immunoractive puncta co-localized with PSD-95. J. Merged image of inset Shank 1A (red), PSD-95 (blue), and YFP (yellow). Primary antibodies were detected using a secondary goat anti-rabbit Alexa 568 IgG for Shank 1A, and a goat anti-mouse Alexa 633 IgG to PSD-95. Scale bar is 5 µm.

Article Snippet: Three Shank 1 antibodies were used for this study: 1) a rabbit polyclonal antibody raised against the COOH-terminal region of Shank 1A (1∶1000) using the product of pGex4T-1 synamon-16, which is the COOH-terminal region of Shank 1A (a generous gift from Dr. Yukata Hata, Tokyo Medical and Dental University, Tokyo, Japan ; 2) a rabbit polyclonal antibody raised against the following sequence SGPIYPGLFDIRSS in the COOH-terminal region of Shank 1A (1∶500–1∶1000) (Catalog No. RA19016, Neuromics, Edina, MN); and 3) a guinea pig polyclonal Shank 1 antibody (1∶20–1∶25) was generated through the use of a glutathione S-transferase (GST)-fusion of the PDZ domain of SSTRIP/Shank 1.

Techniques: Labeling, Fluorescence

High magnification zoom of a region in the OPL. A–H : Confocal images from the mouse thy-1.2 YFP 16 line immunolabeled with Shank 1A and CtBP2 (a homologue of RIBEYE), a marker of synaptic ribbons in mammalian retina. A. Shank 1A (red). B. CtBP2 (blue). C. A combined fluorescence image showing Shank 1A (red) and CtBP2 (blue). D. A schematic illustrating the zoomed confocal image in H, showing that the Shank 1A puncta (red) is located distal and adjacent to the tips of the YFP dendrite (yellow), and are surrounded by CtBP2 labeled synaptic ribbon protein structures (blue). E. YFP (yellow) F. A combined fluorescence image showing Shank 1A (red) and YFP (yellow). G. A combined fluorescence image showing CtBP2 (blue) and YFP (yellow). H. A combined triple labeled image showing Shank 1A (red), CtBP2 (blue), and YFP (yellow). Scale bar = 10 µm.

Journal: PLoS ONE

Article Title: Association of Shank 1A Scaffolding Protein with Cone Photoreceptor Terminals in the Mammalian Retina

doi: 10.1371/journal.pone.0043463

Figure Lengend Snippet: High magnification zoom of a region in the OPL. A–H : Confocal images from the mouse thy-1.2 YFP 16 line immunolabeled with Shank 1A and CtBP2 (a homologue of RIBEYE), a marker of synaptic ribbons in mammalian retina. A. Shank 1A (red). B. CtBP2 (blue). C. A combined fluorescence image showing Shank 1A (red) and CtBP2 (blue). D. A schematic illustrating the zoomed confocal image in H, showing that the Shank 1A puncta (red) is located distal and adjacent to the tips of the YFP dendrite (yellow), and are surrounded by CtBP2 labeled synaptic ribbon protein structures (blue). E. YFP (yellow) F. A combined fluorescence image showing Shank 1A (red) and YFP (yellow). G. A combined fluorescence image showing CtBP2 (blue) and YFP (yellow). H. A combined triple labeled image showing Shank 1A (red), CtBP2 (blue), and YFP (yellow). Scale bar = 10 µm.

Article Snippet: Three Shank 1 antibodies were used for this study: 1) a rabbit polyclonal antibody raised against the COOH-terminal region of Shank 1A (1∶1000) using the product of pGex4T-1 synamon-16, which is the COOH-terminal region of Shank 1A (a generous gift from Dr. Yukata Hata, Tokyo Medical and Dental University, Tokyo, Japan ; 2) a rabbit polyclonal antibody raised against the following sequence SGPIYPGLFDIRSS in the COOH-terminal region of Shank 1A (1∶500–1∶1000) (Catalog No. RA19016, Neuromics, Edina, MN); and 3) a guinea pig polyclonal Shank 1 antibody (1∶20–1∶25) was generated through the use of a glutathione S-transferase (GST)-fusion of the PDZ domain of SSTRIP/Shank 1.

Techniques: Immunolabeling, Marker, Fluorescence, Labeling

A–D : Combined labeling of Shank 1A, PNA, and YFP in the mouse thy-1.2 YFP 16 line vertical retinal section. A. Shank 1A labels both the OPL and IPL. The immunoreactive puncta in the OPL are indicative of cone photoreceptor labeling. B. PNA conjugated rhodamine labels the inner and outer segments of cone photoreceptors, and cone photoreceptor terminals in the OPL. C. YFP fluorescence is present in bipolar, amacrine, and ganglion cells. D. Combined triple fluorescence channel image of PNA (red), Shank 1A (blue), and YFP (yellow). A box is drawn of a region in the OPL and high magnification images are shown in E–H. E–H : High magnification zoom of a region in the OPL from D. E. Shank 1A (blue). F. PNA (red). G. YFP labeled cone bipolar cells and their dendrites (yellow). H. A combined triple labeled fluorescent image showing that Shank 1A (blue) is expressed at the same site as PNA (red) above the YFP cone bipolar cell dendrites (yellow). OS = outer segment, IS = inner segment, ONL = outer nuclear layer, OPL = outer plexiform layer, INL = inner nuclear layer, IPL = inner plexiform layer, and GCL = ganglion cell layer. Scale bars is 10 µm.

Journal: PLoS ONE

Article Title: Association of Shank 1A Scaffolding Protein with Cone Photoreceptor Terminals in the Mammalian Retina

doi: 10.1371/journal.pone.0043463

Figure Lengend Snippet: A–D : Combined labeling of Shank 1A, PNA, and YFP in the mouse thy-1.2 YFP 16 line vertical retinal section. A. Shank 1A labels both the OPL and IPL. The immunoreactive puncta in the OPL are indicative of cone photoreceptor labeling. B. PNA conjugated rhodamine labels the inner and outer segments of cone photoreceptors, and cone photoreceptor terminals in the OPL. C. YFP fluorescence is present in bipolar, amacrine, and ganglion cells. D. Combined triple fluorescence channel image of PNA (red), Shank 1A (blue), and YFP (yellow). A box is drawn of a region in the OPL and high magnification images are shown in E–H. E–H : High magnification zoom of a region in the OPL from D. E. Shank 1A (blue). F. PNA (red). G. YFP labeled cone bipolar cells and their dendrites (yellow). H. A combined triple labeled fluorescent image showing that Shank 1A (blue) is expressed at the same site as PNA (red) above the YFP cone bipolar cell dendrites (yellow). OS = outer segment, IS = inner segment, ONL = outer nuclear layer, OPL = outer plexiform layer, INL = inner nuclear layer, IPL = inner plexiform layer, and GCL = ganglion cell layer. Scale bars is 10 µm.

Article Snippet: Three Shank 1 antibodies were used for this study: 1) a rabbit polyclonal antibody raised against the COOH-terminal region of Shank 1A (1∶1000) using the product of pGex4T-1 synamon-16, which is the COOH-terminal region of Shank 1A (a generous gift from Dr. Yukata Hata, Tokyo Medical and Dental University, Tokyo, Japan ; 2) a rabbit polyclonal antibody raised against the following sequence SGPIYPGLFDIRSS in the COOH-terminal region of Shank 1A (1∶500–1∶1000) (Catalog No. RA19016, Neuromics, Edina, MN); and 3) a guinea pig polyclonal Shank 1 antibody (1∶20–1∶25) was generated through the use of a glutathione S-transferase (GST)-fusion of the PDZ domain of SSTRIP/Shank 1.

Techniques: Labeling, Fluorescence

A–C : A. Shank 1A B. WGA labeling at the OPL. Arrowheads indicate WGA rod spherule labeling, and arrows indicate the location of WGA labeling of cone pedicles. C. YFP cone bipolar cell dendrites. D–F : Shank 1A (blue) and WGA (red) co-localize at cone terminals in the OPL. G–I: YFP cone bipolar cell dendrites (yellow) synapse with WGA (red) labeled cone terminals, which cradle Shank 1A immunoreactive puncta (blue). Scale bar is 10 µm.

Journal: PLoS ONE

Article Title: Association of Shank 1A Scaffolding Protein with Cone Photoreceptor Terminals in the Mammalian Retina

doi: 10.1371/journal.pone.0043463

Figure Lengend Snippet: A–C : A. Shank 1A B. WGA labeling at the OPL. Arrowheads indicate WGA rod spherule labeling, and arrows indicate the location of WGA labeling of cone pedicles. C. YFP cone bipolar cell dendrites. D–F : Shank 1A (blue) and WGA (red) co-localize at cone terminals in the OPL. G–I: YFP cone bipolar cell dendrites (yellow) synapse with WGA (red) labeled cone terminals, which cradle Shank 1A immunoreactive puncta (blue). Scale bar is 10 µm.

Article Snippet: Three Shank 1 antibodies were used for this study: 1) a rabbit polyclonal antibody raised against the COOH-terminal region of Shank 1A (1∶1000) using the product of pGex4T-1 synamon-16, which is the COOH-terminal region of Shank 1A (a generous gift from Dr. Yukata Hata, Tokyo Medical and Dental University, Tokyo, Japan ; 2) a rabbit polyclonal antibody raised against the following sequence SGPIYPGLFDIRSS in the COOH-terminal region of Shank 1A (1∶500–1∶1000) (Catalog No. RA19016, Neuromics, Edina, MN); and 3) a guinea pig polyclonal Shank 1 antibody (1∶20–1∶25) was generated through the use of a glutathione S-transferase (GST)-fusion of the PDZ domain of SSTRIP/Shank 1.

Techniques: Labeling

A–D : Shank 1A is co-localized with glycogen phsophorylase (cone photoreceptor marker). A–D : Combined labeling of Shank 1A, glycogen phosphorylase, and YFP in a vertical retinal section. A. Shank 1A labels both the OPL and IPL. The immunoreactive puncta in the OPL are indicative of cone photoreceptor labeling. B. YFP fluorescence is present in bipolar, amacrine, and ganglion cells. C. Glycogen phosphorylase (GP), a cone photoreceptor marker strongly labels the cone terminals with faint labeling of bipolar cell bodies and their axons. D. Combined triple label fluorescence image of Shank 1A (red), YFP (yellow), and glycogen phosphorylase (GP) (blue), and. A box is drawn of a region in the OPL and high magnification images are shown in E–J. E–J : High magnification zoom of a region in the OPL from the inset above in . E. Shank 1A. F. Merge of Shank 1A (red) and YFP (yellow), showing that Shank 1A (red) is expressed above the cone bipolar cell dendrites (yellow). G. Glycogen phosphorylase (GP). H. Merge of Shank 1A (red) and Glycogen phosphorylase (GP), the two immunoreactivities (pink) indicate co-localization of Shank 1a and Glycogenphosphorylase (GP). I. YFP labeled cone bipolar cells and their dendrites. J. Combined image of Shank 1A (red), glycogen phosphorylase (blue), and YFP cone bipolar cell dendrites (yellow). OPL = outer plexiform layer, INL = inner nuclear layer, IPL = inner plexiform layer, and GCL = ganglion cell layer. Scale bar is 10 µm.

Journal: PLoS ONE

Article Title: Association of Shank 1A Scaffolding Protein with Cone Photoreceptor Terminals in the Mammalian Retina

doi: 10.1371/journal.pone.0043463

Figure Lengend Snippet: A–D : Shank 1A is co-localized with glycogen phsophorylase (cone photoreceptor marker). A–D : Combined labeling of Shank 1A, glycogen phosphorylase, and YFP in a vertical retinal section. A. Shank 1A labels both the OPL and IPL. The immunoreactive puncta in the OPL are indicative of cone photoreceptor labeling. B. YFP fluorescence is present in bipolar, amacrine, and ganglion cells. C. Glycogen phosphorylase (GP), a cone photoreceptor marker strongly labels the cone terminals with faint labeling of bipolar cell bodies and their axons. D. Combined triple label fluorescence image of Shank 1A (red), YFP (yellow), and glycogen phosphorylase (GP) (blue), and. A box is drawn of a region in the OPL and high magnification images are shown in E–J. E–J : High magnification zoom of a region in the OPL from the inset above in . E. Shank 1A. F. Merge of Shank 1A (red) and YFP (yellow), showing that Shank 1A (red) is expressed above the cone bipolar cell dendrites (yellow). G. Glycogen phosphorylase (GP). H. Merge of Shank 1A (red) and Glycogen phosphorylase (GP), the two immunoreactivities (pink) indicate co-localization of Shank 1a and Glycogenphosphorylase (GP). I. YFP labeled cone bipolar cells and their dendrites. J. Combined image of Shank 1A (red), glycogen phosphorylase (blue), and YFP cone bipolar cell dendrites (yellow). OPL = outer plexiform layer, INL = inner nuclear layer, IPL = inner plexiform layer, and GCL = ganglion cell layer. Scale bar is 10 µm.

Article Snippet: Three Shank 1 antibodies were used for this study: 1) a rabbit polyclonal antibody raised against the COOH-terminal region of Shank 1A (1∶1000) using the product of pGex4T-1 synamon-16, which is the COOH-terminal region of Shank 1A (a generous gift from Dr. Yukata Hata, Tokyo Medical and Dental University, Tokyo, Japan ; 2) a rabbit polyclonal antibody raised against the following sequence SGPIYPGLFDIRSS in the COOH-terminal region of Shank 1A (1∶500–1∶1000) (Catalog No. RA19016, Neuromics, Edina, MN); and 3) a guinea pig polyclonal Shank 1 antibody (1∶20–1∶25) was generated through the use of a glutathione S-transferase (GST)-fusion of the PDZ domain of SSTRIP/Shank 1.

Techniques: Marker, Labeling, Fluorescence

Antibodies and Lectins.

Journal: PLoS ONE

Article Title: Association of Shank 1A Scaffolding Protein with Cone Photoreceptor Terminals in the Mammalian Retina

doi: 10.1371/journal.pone.0043463

Figure Lengend Snippet: Antibodies and Lectins.

Article Snippet: Three Shank 1 antibodies were used for this study: 1) a rabbit polyclonal antibody raised against the COOH-terminal region of Shank 1A (1∶1000) using the product of pGex4T-1 synamon-16, which is the COOH-terminal region of Shank 1A (a generous gift from Dr. Yukata Hata, Tokyo Medical and Dental University, Tokyo, Japan ; 2) a rabbit polyclonal antibody raised against the following sequence SGPIYPGLFDIRSS in the COOH-terminal region of Shank 1A (1∶500–1∶1000) (Catalog No. RA19016, Neuromics, Edina, MN); and 3) a guinea pig polyclonal Shank 1 antibody (1∶20–1∶25) was generated through the use of a glutathione S-transferase (GST)-fusion of the PDZ domain of SSTRIP/Shank 1.

Techniques: Sequencing, Generated, Binding Assay, Recombinant, Transduction, Plasmid Preparation

KEY RESOURCES TABLE

Journal: Cell host & microbe

Article Title: Maternal immunization confers protection to the offspring against an attaching and effacing pathogen through delivery of IgG in breast milk

doi: 10.1016/j.chom.2018.12.015

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Cat#: 030988-MU; RRID: MMRRC_030988-MU Oligonucleotides pQE60-EspA-F: GGTTTACCCATGGATACATCAACTATG This paper N/A pQE60-EspA-R: TATCTCGGATCCTTTGCCAATGGGTATTGCTG This paper N/A pQE60-EspB-F: CGAGACCATGGATACTATCGATTATAACAATGC This paper N/A pQE60-EspB-R: AATGTTGGATCCCCCTGCTAAACGAGCCGATTG This paper N/A Recombinant DNA Plasmid pQE60 QIAGEN Cat#: 32903 Plasmid pQE60-EspA This paper N/A Plasmid pQE60-EspB This paper N/A Plasmid pREP4 QIAGEN N/A Plasmid p6his-Intb385 Dr. Alison D. O’Brien ( Sinclair and O’Brien, 2004 ) N/A Software and Algorithms GraphPad Prism version 7 GraphPad Software https://www.graphpad.com/ Living Image Software PerkinElmer http://www.perkinelmer.com/lab-products-and-services/resources/in-vivo-imaging-software-downloads.html#LivingImage Open in a separate window KEY RESOURCES TABLE

Techniques: Virus, Recombinant, Modification, Bradford Protein Assay, Western Blot, Plasmid Preparation, Software